A new and improved PCR method for detection of AHPND bacteria
18 June 2014 | 5900 views
Ratchanok Sirikharin1,2,3, Suparat Taengchaiyaphum1, Kallaya Sritunyalucksana1,2, Siripong Thitamadee1,3, Timothy W. Flegel1,5, Rapeepat Mavichak6 and Porranee Proespraiwong6
1. Centex Shrimp, Faculty of Science, Mahidol University, RamaVI Rd., Bangkok, Thailand
2. Shrimp-virus Interaction Laboratory (ASVI), National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Rama VI Rd., Bangkok, Thailand
3. Department of Biotechnology, Faculty of Science, Mahidol University, RamaVI Rd., Bangkok, Thailand
5. National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Pathumthani, 12120, Thailand
6. Aquatic Animal Health Research Center, Charoen Pokphand Co. Ltd., 82/2 M. 4, Rama 2 Rd., Km 41.5, T. Bangtorat, A. Muang Samutsakorn, Samutsakorn 74000, Thailand
Background
Here we describe a new method for detecting isolates of Vibrio parahaemolyticus that cause acute hepatopancreatic necrosis disease (AHPND). This method is based on the gene sequence of a protein discovered in a sub-fraction of cell-free culture broth from isolates of V. parhaemolyticus that cause AHPND, but not from V. parahaemolyticus or other bacteria that do not cause AHPND. This cell-free preparation caused the typical signs of acute AHPND (massive sloughing of hepatopancreatic tubule epithelial cells) when administered to shrimp by reverse gavage. It contained two prominent protein bands of 58 and 12 kDa. After mass spectrometery of peptide fragments derived separately from these proteins and after subsequent analysis by MASCOT, it was revealed that they had significant homology to bacterial toxins against insects. Primers were designed to amplify the complete gene sequences for these proteins from AHPND bacteria. After sequencing of the resulting amplicons, primers were designed for PCR methods to detect each of these protein genes, and preliminary tests with a few isolates of AHPND and non-AHPND bacterial isolates revealed that both methods gave positive results for all the AHPND isolates but that the 58 kDa protein alone also gave positive results for some non-AHPND isolates. Thus, further tests were carried out using the PCR method for the 12 kDa protein only. The 98 bacterial isolates tested consisted of non-AHPND (35) and AHPND (49) V. parahaemolyticus isolates (total 84) confirmed by bioassay and 14 other isolates of bacteria commonly found in shrimp ponds including other species of Vibrio and Photobacterium. Results for all 49 AHPND isolates were positive with the test while results for all the remaining isolates were negative. This gave 100% sensitivity, specificity, positive predictive value and negative predictive value for the new method when compared to 100% sensitivity, 97.7% specificity, 97.4% positive predictive value and 100% negative predictive value for the previously recommended AP2 PCR method that was evaluated using a similar set of 80 bacterial isolates. The isolate that gave a false positive test result in the test with the AP2 method was included in the test of the new method and it gave a correct, negative test result.
From these results, we recommend that our previously announced AP1 and AP2 primer methods be replaced with this new method which, for convenience, we would like to call the AP3 primer method. We would also like to suggest caution in calling the 12 kDa protein a toxin, since toxicity assays of its heterologously expressed form have not been completed. Nor have they been done with the 58 kDa protein. Even though these two proteins give dominant bands in the bioactive culture broth fraction from AHPND bacteria, and even though they have similarity to previously reported insect toxins, they may or may not be responsible for massive cell sloughing characteristic of AHPND. Despite this uncertainty, the utility of the AP3 method has been shown to be superior that of AP2 and, as before, we would like the tools for detection of AHPND bacteria be freely dispersed and applied as soon as possible in an effort to control the spread of this new disease.
The sequence of the AP3 primer target plus the primers and PCR protocol are given freely below for application in detecting AHPND bacteria. For those who have previously identified V. parahaemolyticus isolates that give positive PCR test results with the AP2 method but have not yet carried out bioassays with shrimp, we recommend additional testing with AP3 method before doing so. As previously recommended for the AP2 method, we do not recommend adaptation of this method to nested PCR. The 1-step PCR method is sensitive enough with DNA extracts from bacterial isolates. However, for samples from shrimp tissues such as the HP and stomach, from broodstock or juvenile shrimp feces, from whole post larvae and other suspected carriers and from environmental sources such as pond sediment, we recommend a preliminary enrichment step in TSB containing 1.5% NaCl supplement incubated for 4 hr at around 30°C with shaking. After this, let any debris settle and then remove the cloudy supernatant, centrifuge to pellet the bacteria and discard the supernatant solution. Extract DNA from the bacterial pellet and use about 100 ng of template for each PCR test.
Details of the PCR method
PCR primers
|
AP3 |
5’-3’ |
Length |
%GC |
Tm |
Ta |
Expected amplicon |
|
F |
ATGAGTAACAATATAAAACATGAAAC |
26 |
23.08 |
57.63 |
53 |
336 bp |
|
R |
GTGGTAATAGATTGTACAGAA |
21 |
33.33 |
55.46 |
PCR reaction conditions
|
Components |
µl |
|
Protocol |
|
|
|
10x PCR mix |
2.5 |
|
Denature |
94°C, 5 min |
|
|
50 mM MgCl2 |
0.7 |
|
30 cycles |
|
|
|
|
|
|
Denature |
94°C, 30 sec |
|
|
10 mM dNTPs |
0.4 |
|
Annealing |
53°C, 30 sec |
|
|
10 µM CN2-F1 |
0.5 |
|
Extension |
72°C, 40 sec |
|
|
10 µM CN2-R1 |
0.5 |
|
Final |
72°C, 5 min |
|
|
Taq DNA pol |
0.2 |
|
|
|
|
|
Total |
25.0 |
|
|
|
|
>AP3 target sequence 336 bp
ATGAGTAACAATATAAAACATGAAACTGACTATTCTCACGATTGGACTGTCGAACCAAACGGAG
GCGTCACAGAAGTAGACAGCAAACATACACCTATCATCCCGGAAGTCGGTCGTAGTGTAGACAT
TGAGAATACGGGACGTGGGGAGCTTACCATTCAATACCAATGGGGTGCGCCATTTATGGCTGGC
GGCTGGAAAGTGGCTAAATCACATGTGGTACAACGTGATGAAACTTACCATTTACAACGCCCTG
ATAATGCATTCTATCATCAGCGTATTGTTGTAATTAACAATGGCGCTAGTCGTGGTTTCTGTAC
AATCTATTACCAC
Acknowledgements
This PCR method and the underlying proteomic work was developed entirely by Thai scientists working and Thailand at Centex Shrimp and the Aquatic Animal Health Research Center. It was also supported entirely by research funding from Thailand. The work took place after the groundbreaking publication of Tran, Nunan, Redman, Mohney, Pantoja, Fitzsimmons and Lightner (Dis Aquat Org 105: 45-55) in early 2013. However, it also employed information and materials acquired long before that. Thus, we would like to acknowledge the support and encouragement for our research on AHPND from the Agriculture Research and Development Agency, the National Research Council of Thailand, the Thai Commission for Higher Education, Mahidol University, the National Science and Technology Development Agency, the Patani Shrimp Farmers Club, the Surathani Shrimp Farmers Club, the Thai Frozen Foods Association, Charoen Pokphand Company, SyAqua Co. Ltd. and Thai Union Co. Ltd.
Copyright, all rights reserved.